rs6564635 chr16:73312135 A>G
- Sequence
caaaataaggagcttgaaattgtg[A/G]cacgtgacaaaaggatgaaggaag
- ASB for transcription factors
- RAD51_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD51_HUMAN | 1.86 | -1.59 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hypertension (early onset hypertension), obesity with early age of onset (age >2), salmonella-induced pyroptosis