rs6567311 chr18:63016273 G>A
- Sequence
cctggccctgcacgcatattttct[G/A]gaaaaagtacagaagatttatttc
- ASB in cell types
- bipolar neuron IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 1.93 | -1.93 | 1.00 | |||
| IPSC-derived bipolar neuron | 2.31 | -0.82 | 1.00 |
Items per page:
1 – 2 of 2