rs6567594 chrX:3711839 T>A
- Sequence
agaggaggagaaatgcagagagac[T/A]tgaacagagacagaaagagggaga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.52 | 0.99 | 1.13 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 2.06 | n/a | 1.00 |
Items per page:
1 – 2 of 2