rs6568431 chr6:106140931 A>C
- Sequence
acttcagtcagctaggaaagatac[A/C]cttttggcagggtgcggtggctca
- ASB in cell types
- MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 1.13 | -1.17 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP anti-dsdna autoantibody status in systemic lupus erythematosus (sle) patients, height, rheumatoid arthritis, sarcoidosis, selective immunoglobulin a deficiency (igad), systemic lupus erythematosus (sle), systemic lupus erythematosus (sle) (females)