rs6568468 chr6:107151745 G>A
- Sequence
agtgagtgaggtttgcaggagcca[G/A]ctgacaatttggggggtgctaggc
- ASB in cell types
- MCF10A (breast epithelial cells)
- ASB for transcription factors
- TEAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD4_HUMAN | 2.69 | -2.48 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, barnes akathisia rating scale, college completion, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol, microalbuminuria, prop taste detection threshold, years of education
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal