rs6569621 chr6:129685725 T>G
- Sequence
tcacggtgatcacttgatagtttt[T/G]tccatattcaaaaatacaaggcag
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | n/a | 2.95 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1