rs6569648 chr6:130027974 C>T
- Sequence
tgactcaaattgaggtatagtctg[C/T]acgttgaacatgaatttaaaataa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.78 | -0.06 | 1.12 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI body mass index, breast cancer, breast cancer (estrogen-receptor negative), hair color, height, hip circumference, lymphocyte counts
GRASP 2 hour glucose, acute lung injury following major trauma, age at first tooth, birth weight and adult height, body mass index (bmi), height, homa-b, infant head circumference, late onset alzheimers disease, myopia, refractive error, serum creatinine, tetrology of fallot, triglycerides, waist hip ratio
PheWAS abnormal cytological, histological, immunological and dna test findings, abnormal findings on study of brain, nervous system, abnormal serum enzyme levels, abnormal sputum, abnormal tumor markers, elevated cea or ca 125, acute bronchospasm, adverse effects of hormones and synthetic substitutes, bacteremia, bursitis, calculus of kidney, cholecystitis without cholelithiasis, cholelithiasis and cholecystitis, chronic liver disease and cirrhosis, circumscribed scleroderma, coagulation defects, complication of amputation stump, dermatophytosis of the body, diabetes mellitus, diplopia and disorders of binocular vision, disorders of liver, dysmenorrhea, e. coli, elevated levels of transaminase or lactic acid dehydrogenase, eye infection, viral, fibroadenosis of breast, heart valve replaced, heartburn, hemoptysis, hemorrhagic disorder due to intrinsic circulating anticoagulants, hyperglyceridemia, hypermetropia, hypotension, infections of kidney, inflammation of the eye, inflammatory conditions of jaw, influenza, jaw disease nos, keratitis, infectious, keratoconjunctivitis, noninfectious, kyphosis (acquired), liver replaced by transplant, mechanical complication due to other implant and internal device, muscular wasting and disuse atrophy, neuralgia, neuritis, and radiculitis nos, nonrheumatic mitral valve disorders, nontoxic uninodular goiter, open wound of lip and mouth, other congenital anomalies of skin, other disorders of bladder, other disorders of metabolic, endocrine, immunity disorders, other signs and symptoms in breast, other unspecified back disorders, phobia, polyneuropathy in diabetes, premenstrual tension syndromes, psychogenic and somatoform disorders, psychogenic disorder, retinoschisis and retinal cysts, sciatica, scleritis and episcleritis, secondary malignancy of brain/spine, septicemia, sialoadenitis, somatoform disorder, stomatitis and mucositis, stress incontinence, female, type 1 diabetes, type 1 diabetic ketoacidosis, type 2 diabetes, type 2 diabetic nephropathy, type 2 diabetic neuropathy, type 2 diabetic retinopathy, umbilical hernia, urinary incontinence
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood