rs6569928 chr6:134109737 C>T
- Sequence
cgttaagagaaatgtgtcattagg[C/T]gatttcatcattgtgcaaacatca
- ASB in cell types
- MDA-MB-453 (breast adenocarcinoma) breast tumor xenograft
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-453 (breast adenocarcinoma) | 2.27 | -1.46 | 1.00 | |||
| breast tumor xenograft | 1.11 | 0.12 | 1.00 |
Items per page:
1 – 2 of 2