rs6570642 chr6:100300508 G>A
- Sequence
taaaccaatctccaatcccattcc[G/A]cttcctgggggtcggggaatgggg
- ASB in cell types
- hTERT-HME1(Telomerase immortalized cell line)
- ASB for transcription factors
- BRCA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRCA2_HUMAN | 1.16 | -0.95 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, birth weight, obesity with early age of onset (age >2)