rs6570819 chr6:148170438 C>T
- Sequence
aactgtctagaggtgttttgttag[C/T]tatctttcagccccttctttaaaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- TAL1_HUMAN ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 0.13 | 2.70 | 1.38 | 1.54 | Weak Concordant | |||
| ARI1B_HUMAN | -1.71 | 1.71 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP cognitive response to topiramate treatment as measured by the changepc1 (overall cognition) cognitive test, cystatin c in serum