rs6572027 chr14:40591137 A>T
- Sequence
gtgccattaggtaattcacaatca[A/T]tgttatatatcattactatgacaa
- ASB in cell types
- naive endoderm
- ASB for transcription factors
- CDX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDX2_HUMAN | -2.34 | 2.45 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol change with statins, serum creatinine, total cholesterol change with statins