rs6573380 chr14:61344262 A>G
- Sequence
gaaaataaatgtaaaatgcctggc[A/G]ccactgaggaagtagggtgaggag
- ASB in cell types
- MDM(monocyte derived macrophages) macrophages form periferal blood monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN KAISO_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.24 | 2.70 | 1.96 | n/a | No Hit | |||
| KAISO_HUMAN | -3.67 | 3.35 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2