rs6573604 chr14:65321223 T>C
- Sequence
ccaagaaaccaggtttggttctta[T/C]ctcttaacttcctttttgttctgc
- ASB in cell types
- ER+ breast tumor MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.39 | 1.88 | 2.11 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biantennary nongalactosylated glycans, biantennary nongalactosylated glycans in men, biantennary nongalactosylated glycans in women, desialylated glycan peak 1, desialylated glycan peak 1 in men, desialylated glycan peak 1 in women, glycan peak 1, glycan peak 1 in men, glycan peak 1 in women, hdl cholesterol, ldl cholesterol, rheumatoid arthritis