rs6573842 chr14:68571220 T>C
- Sequence
gctgcagtgctgggtacaaccatg[T/C]cagttcaaaccagattcaatttgg
- ASB in cell types
- liver
- ASB for transcription factors
- HNF4A_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | -1.29 | 1.86 | 1.00 | n/a | No Hit | |||
| RAD21_HUMAN | -1.09 | 1.65 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, crohns disease, combined control dataset, fasting insulin, ldl cholesterol, major depressive disorder