rs6574214 chr14:75230359 A>G
- Sequence
ccttgccactcccagtatgggggc[A/G]gagtgactagggaacagcttacaa
- ASB in cell types
- BEAS-2B (bronchial epithelium) PC9 (lung adenocarcinoma)
- ASB for transcription factors
- ZFHX2_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFHX2_HUMAN | n/a | 3.12 | 2.00 | n/a | n/a | |||
| GCR_HUMAN | -0.33 | 1.48 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, height, homa-ir, late onset alzheimers disease, obesity with early age of onset (age >2)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood