rs6574330 chr14:76813018 A>T
- Sequence
agccggttcccatggcaactagcc[A/T]cccctagcacccggctgccaccca
- ASB in cell types
- germinal center B-cells T47D (invasive ductal carcinoma) CD14+ monocytes GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CBP_HUMAN ESR1_HUMAN STAT1_HUMAN KDM5B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CBP_HUMAN | n/a | 2.14 | 2.00 | n/a | n/a | |||
| ESR1_HUMAN | 0.27 | 1.39 | 1.58 | n/a | No Hit | |||
| STAT1_HUMAN | -0.07 | 2.17 | 2.50 | n/a | No Hit | |||
| KDM5B_HUMAN | 0.09 | 1.42 | 2.21 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid