rs6575334 chr14:93431261 C>T
- Sequence
tgtccccggtgctgaaaaataata[C/T]ggtcttcctcgggctccagcgggg
- ASB in cell types
- Jurkat (T-cells) MCF7 (Invasive ductal breast carcinoma) Ishikawa (endometrial adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Jurkat (T-cells) | -2.56 | 2.90 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.43 | 1.89 | 1.50 | |||
| Ishikawa (endometrial adenocarcinoma) | 0.01 | 1.44 | 1.00 |
Items per page:
1 – 3 of 3