rs6578196 chr8:141508012 G>T
- Sequence
cgcacagcaatcagtggtggagat[G/T]agcctcaaactcaggtccccagac
- ASB in cell types
- HeLa (cervical adenocarcinoma) MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa (cervical adenocarcinoma) | n/a | 1.48 | 3.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 1.43 | -0.14 | 1.50 |
Items per page:
1 – 2 of 2