rs6579003 chr11:2211080 A>C
- Sequence
gggagcaggatgccctggggacac[A/C]ctgccctgtgcagcccggcctctg
- ASB in cell types
- primary endometrium cancer
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary endometrium cancer | -4.65 | 2.55 | 2.00 |
Items per page:
1 – 1 of 1