rs6580205 chr5:141915126 T>C
- Sequence
ttacttgtaacattgtccaggaaa[T/C]tcttcccgattcatttctgcccaa
- ASB for transcription factors
- RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | 1.57 | -0.47 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), obesity with early age of onset (age >2), serum creatinine, waist hip ratio
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Liver, Muscle_Skeletal, Testis