rs6580598 chr5:149154189 A>G
- Sequence
agcttgcagcagcaggggcagccc[A/G]aggtctattcctatgttttgagat
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 1.04 | 0.50 | 1.62 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, acute lung injury following major trauma, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, cystatin c in serum, ldl cholesterol change with statins, major depressive disorder, panic disorder, serum creatinine, total cholesterol