rs6580970 chr12:54040493 C>T
- Sequence
ctcctctgtcagtccctgaaccaa[C/T]tctgaggagtctttggcttgtctc
- ASB in cell types
- HEK293 (embryonic kidney) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.82 | 0.01 | 1.99 | |||
| bipolar neuron | 2.09 | -1.79 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg