rs658144 chr1:236349820 G>A
- Sequence
aggaaaaaaaaagggcagtggtgg[G/A]ggagggtggtggcaggcgcggtgg
- ASB in cell types
- K562 (myelogenous leukemia) TF-1 (erythroleukemia) SKH1 (chronic myelogenous leukemia, BCR-ABL1 positive)
- ASB for transcription factors
- GATA2_HUMAN SMC3_HUMAN TIF1A_HUMAN ZN148_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA2_HUMAN | 0.75 | 2.89 | 1.67 | n/a | No Hit | |||
| SMC3_HUMAN | n/a | 3.52 | 2.00 | n/a | n/a | |||
| TIF1A_HUMAN | 1.35 | n/a | 3.00 | n/a | n/a | |||
| ZN148_HUMAN | 2.92 | n/a | 3.50 | n/a | n/a | |||
| HTF4_HUMAN | 0.84 | -0.34 | 2.50 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Testis