rs6582316 chr12:75933921 A>G
- Sequence
tacatggtgcctgaatagagggtg[A/G]ggatgaggaaagagatgacaaatc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | -5.04 | 1.95 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP autism with low iq, prop taste detection threshold, salmonella-induced pyroptosis, stabilized warfarin dose, triglycerides change with statins