rs6585419 chr10:116797028 A>G
- Sequence
aactcttcttgaggtcctccaaag[A/G]aatcccacagaagtgaaccccacc
- ASB in cell types
- A549 (lung carcinoma) KMS-11 (Plasma cell myeloma) GM18505 (female B-cells Lymphoblastoid Cell Lines) hASC (preadipocytes)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.37 | 1.23 | 2.00 | |||
| KMS-11 (Plasma cell myeloma) | 0.62 | 3.01 | 2.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -0.51 | 0.93 | 1.00 | |||
| hASC (preadipocytes) | -1.02 | 1.51 | 1.00 | |||
| LNCaP (prostate carcinoma) | 0.85 | -0.44 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, hypertension (early onset hypertension), maternal transmission distortion, mitral annular calcium, paternal transmission distortion, psychological test results: animals test, transmission distortion