rs6586051 chr10:80528421 A>G
- Sequence
taaatctccctttatagggaactt[A/G]gggcccagtctgtggtgggtggat
- ASB in cell types
- MV-4-11 (Childhood acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MV-4-11 (Childhood acute monocytic leukemia) | -0.66 | 1.59 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Mucosa, Lung, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood