rs6586198 chr10:89564020 T>C
- Sequence
aatttcactaaccagtatgggcaa[T/C]gaccaggaaattcccaggaaagta
- ASB in cell types
- A549 (lung carcinoma) TTC-1240 (Rhabdoid tumor of the kidney) KMS-11 (Plasma cell myeloma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.13 | 0.66 | 1.08 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, hdl cholesterol change with statins, height, ldl cholesterol, paternal transmission distortion, total cholesterol