rs6586290 chr21:41995774 T>C
- Sequence
aggtctaggaggaaaaaatggttt[T/C]gtgggccaggcccagggccccctt
- ASB for transcription factors
- SUMO2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SUMO2_HUMAN | 2.63 | -2.67 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Liver, Muscle_Skeletal, Spleen