rs6586392 chr1:234500153 A>G
- Sequence
atggaaagcacatttcaatggatg[A/G]gtgatgatttccgaagggcctctg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.16 | 0.60 | 1.05 | |||
| neural cell | 2.03 | -1.40 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP asthma, ldl cholesterol, primary rhegmatogenous retinal detachment, rheumatoid arthritis, total cholesterol