rs6586550 chr1:16909864 G>A
- Sequence
tattttaaattatttatgatttaa[G/A]tctttttttaataattaaaaaaag
- ASB in cell types
- epithelial cell of prostate GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -1.14 | 1.14 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | n/a | 1.49 | 2.50 |
Items per page:
1 – 2 of 2