rs6587948 chr1:61865903 T>C
- Sequence
cctcccttagacatttcctcactt[T/C]gtccctcatgcaaatgctggtggc
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXP1_HUMAN | -2.12 | 2.45 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), fasting insulin, homa-b, homa-ir, microalbuminuria, rheumatoid arthritis, systolic blood pressure (sbp)