rs6588147 chr1:65469811 G>A
- Sequence
ctgagctttaacaccaataagtgc[G/A]tgccgtattcatcctcattctcat
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.12 | 0.87 | 2.00 | |||
| K562 (myelogenous leukemia) | 0.74 | 0.13 | 1.94 |
Items per page:
1 – 2 of 2