rs6589939 chr11:122647817 A>G
- Sequence
tgaaatcagcccattcccttttga[A/G]tatgtcttataattaggaagtgtc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) macrophages form periferal blood THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | -0.01 | 1.69 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI lymphocyte counts, lymphocyte percentage of white cells, neutrophil percentage of white cells
GRASP adiponectin levels, body mass index (bmi), college completion, hdl cholesterol, ldl cholesterol, total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Whole_Blood