rs6600313 chr1:40097321 T>C
- Sequence
gggcgtggcgccgccggttgcaga[T/C]cgcaacctgcgcatcccgaacgga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN ANDR_HUMAN RUNX3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.00 | 1.71 | 1.28 | n/a | No Hit | |||
| ANDR_HUMAN | -1.94 | 3.19 | 2.00 | n/a | No Hit | |||
| RUNX3_HUMAN | -2.66 | 2.57 | 1.00 | 5.20 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood