rs6601209 chr5:178074845 A>G
- Sequence
cagcctgcccatctgtatgcaccc[A/G]tagaggtttgagcagaggcagcac
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines) HeLa (cervical adenocarcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.15 | 3.88 | 1.50 | n/a | No Hit | |||
| STAG1_HUMAN | 3.88 | 0.47 | 1.29 | n/a | n/a |
Items per page:
1 – 2 of 2