rs6601307 chr8:9412365 G>T
- Sequence
tttaaaattacctggtttttaaat[G/T]ctgttttatctttggcaagccaat
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.80 | 0.01 | 1.90 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP autism without verbal ability, college completion, cystatin c in serum, diastolic blood pressure (dbp), hdl cholesterol, systolic blood pressure (sbp), triglycerides
GTEx eQTL Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis