rs663364 chr1:10424359 T>G
- Sequence
tgtgaatgttacatggcaggatta[T/G]agccatccaaaatcggttccaagc
- ASB for transcription factors
- MGAP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MGAP_HUMAN | 2.38 | n/a | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Thyroid