rs6681347 chr1:3955322 C>T
- Sequence
actccctctccactcccatctcta[C/T]gtcacagtaagtcctgagtttgtg
- ASB in cell types
- ESO-26 (Gastroesophageal junction adenocarcinoma)
- ASB for transcription factors
- KLF5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KLF5_HUMAN | 3.34 | -4.81 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, cystatin c in serum, salmonella-induced pyroptosis