rs6682554 chr1:11926564 T>C
- Sequence
aaaagctgccgggggcgggaccac[T/C]cgttcccaggccggaagagtgaag
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- BCOR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BCOR_HUMAN | n/a | 2.67 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, ldl cholesterol, ldl cholesterol change with statins, neuroblastoma (brain cancer), plasma homocysteine, total cholesterol, total cholesterol change with statins, triglycerides change with statins
GTEx eQTL Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood