rs6688051 chr1:15835035 C>G
- Sequence
gtcgcggagaagcacctgctaaat[C/G]ccgtgactccctccccctgccctg
- ASB in cell types
- 22RV1 (prostate carcinoma) MOLM14 (Adult acute myeloid leukemia) neural cell
- ASB for transcription factors
- ANDR_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | n/a | 3.92 | 2.00 | n/a | No Hit | |||
| BRD4_HUMAN | 0.42 | 1.13 | 1.93 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood