rs66943334 chr5:157243906 C>T
- Sequence
ctatctccctgcgcaaactcccag[C/T]agtggcttcctattgcacagagaa
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | 2.26 | -1.02 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -2.48 | 2.73 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Nucleus_accumbens_basal_ganglia, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Whole_Blood