rs6697550 chr1:1679100 A>G
- Sequence
ccccctggctggggacgctgtcac[A/G]gcacccgctacacaggctctgcca
- ASB in cell types
- epithelial cell of prostate HMEC (human mammary epithelial cells) esophagus squamous epithelium GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | 2.27 | -2.05 | 1.00 | |||
| HMEC (human mammary epithelial cells) | 3.00 | -2.74 | 1.00 | |||
| esophagus squamous epithelium | 3.30 | n/a | 2.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.57 | -4.61 | 2.50 | |||
| GM23338 | -2.08 | 2.15 | 1.25 |
Items per page:
1 – 5 of 10
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Colon_Transverse, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Whole_Blood