rs6698889 chr1:161730116 A>G
- Sequence
agcctcccaaagtgcagggattac[A/G]ggcttgggccaccgcgcccggccg
- ASB in cell types
- MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) | 1.91 | -0.86 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Liver, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood