rs6703582 chr1:15272668 G>C
- Sequence
gcacacaggcagcagagacagagt[G/C]gaccctgtggagttctgagtcatt
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) CAR-T cells GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- IRF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IRF4_HUMAN | -0.03 | 1.50 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1