rs6712127 chr2:135004491 A>G
- Sequence
actcgggagagctgcagccttctg[A/G]gaggtgcgaagggatgagaaacac
- ASB in cell types
- foreskin keratinocyte HUVEC-C (HUVEC, umbilical vein endothelial cells) erythroid cells MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line)
- ASB for transcription factors
- JUN_HUMAN ZNF76_HUMAN GLIS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | -0.30 | 1.30 | 1.12 | n/a | No Hit | |||
| ZNF76_HUMAN | -2.56 | 2.48 | 1.00 | 4.94 | Concordant | |||
| GLIS1_HUMAN | -3.97 | 2.14 | 1.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood