rs67149353 chr7:16464307 C>G
- Sequence
tgctcagcgtgcctgattctgcct[C/G]cagctcaccttcctgcagctgcct
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.89 | -0.07 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Nerve_Tibial, Ovary