rs6727504 chr2:60881603 C>G
- Sequence
gctctccccgctccgccccctgcc[C/G]ctggctcccgtacggtggacggcg
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -2.52 | 2.62 | 1.00 | 5.27 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
