rs6734759 chr2:132010446 C>G
- Sequence
tgatgtggaaggaaaagtgcagcg[C/G]aagacaaagatgtaagtaggcttg
- ASB in cell types
- GM23248 HDF(human dermal fibroblasts) Hep 3B2.1-7 (HEP-3B, Hepatocellular carcinoma)
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 2.60 | 0.22 | 1.64 | n/a | n/a |
Items per page:
1 – 1 of 1