rs6740100 chr2:71995226 A>C
- Sequence
actaaggcaccccccttcctcaga[A/C]actttactgccatctgctggaaaa
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines) PC9 (lung adenocarcinoma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.35 | 1.74 | 1.06 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, alzheimers disease, hypertension (early onset hypertension), ldl cholesterol, total cholesterol change with statins