rs678376 chr11:85719354 A>G
- Sequence
caggctagtgtgagagtgggtatc[A/G]gtatttggaagggagcgtgcagga
- ASB in cell types
- BEAS-2B (bronchial epithelium) Detroit 562 (Pharyngeal squamous cell carcinoma) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- GCR_HUMAN TF65_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.97 | 1.08 | 1.09 | n/a | No Hit | |||
| TF65_HUMAN | -0.82 | 1.40 | 1.50 | n/a | No Hit | |||
| SMCA4_HUMAN | -0.42 | 1.35 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid